2008-01-01 2009-02-22 Ferry Slik Cam Webb 1 tree 3 rbcL_1F ATGTCACCACAAACAGAAAC rbcL_724R TCGCATGTACCTGCAGTAGC Macrogen Cam Webb CCCCCCCACAGAAACTAAAGCAAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTT ATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAA CCCGGAGTTCCGCCTGAGGAAGCAGGAGCTGCGGTAGCTGCTGAATCTTCTACCGGTACATGGAC AACTGTGTGGACCGATGGGCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACCACATCGAGC CCGTTGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAG GGTTCTGTTACTAACATGTTTACTTCTATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGTGC CCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATATTAAAACTTTCCAAGGGCCGCCTCATG GCATCCAAGTTGAGAGAGATAAATTGAACAAGTACGGTCGCCCTCTATTGGGTTGTACTATTAAA CCTAAATTGGGGCTATCCGCTAAGAATTATGGTAGAGCAGTTTATGAATGTCTACGCGGCGGACT TGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGACCGTTTCG TATTTTGTGCCGAAGCACTTTATAAAGCACAGGCCGAAACAGGTGAAATCAAAGGACATTATTTG AATGCT 2009-05-21 Mallotus Macaranga trichocarpa (Reichb.f.&Zoll.) Mull.Arg. http://www.asianplant.net/Euphorbiaceae/Macaranga_trichocarpa.htm Indonesia Kalimantan Barat Kayong Utara Sukadana Behind Webb's house in Tanah Merah 109.95371 -1.25530 secondary forest Gently sloping, sandy clay soils, with scattered granite boulders. 0.1 specimens 2008-11-25 Collecting permit S.1714/BTNGP-1/2008 from Balai TNGP Letter S.1714/BTNGP-1/2008 from Balai Taman Nasional Gunung Palung. Permission to collect plants in Taman Nasional Gunung Palung. (Apparently) concurrent with park entrance permit (SIMAKSI, SI.178/Set-3/2008), and (apparently) extendable, as with SIMAKSI. Requires submission of species list to BTNGP before transporting specimens from environs of TNGP. Additional permission required from DirJen PHKA for species covered by PP 7 1999. specimens 2006-11-17 Material Transfer Agreement and Intellectual Property Rights Material Transfer Agreement and Intellectual Property Rights Agreement between Pusat Penelitian Biologi (PPB) LIPI, Bogor and The Arnold Arboretum, Jamaica Plain, MA, USA. Concerning the use and transport of plant specimens (including DNA samples) to other herbaria, for scientific use only. Additional permits needed for CITES-covered plants. ip 2006-11-17 Material Transfer Agreement and Intellectual Property Rights Material Transfer Agreement and Intellectual Property Rights Agreement between Pusat Penelitian Biologi (PPB) LIPI, Bogor and The Arnold Arboretum, Jamaica Plain, MA, USA. Concerning data sharing and publication. research 2008-11-25 2009-02-24 Park entry and research permit from BTNGP, SI.178/Set-3/2008 Surat Izin Masuk Kawasan Konservasi. Park entrance and research permit from PHKA. SI.178/Set-3/2008. Extendable to duration of RisTek research permit, on application to BTNGP. research 2008-11-03 2008-09-02 Research permit No. 2679/FRP/SM/XI/2008 Surat Izin Penelitian. No. 2679/FRP/SM/XI/2008. Research permit from the Indonesian Ministry of Research and Technology. ip 2008-11-03 2008-09-02 Photographic rights sharing Co-ownership of rights to digital photographs of plants are offered voluntarily by Campbell Webb to LIPI, and, where the photographed plant lives in TN Gunung Palung, to BTNGP, for the duration of Webb's research permit. Webb is unaware of any other requirement from the Government of Indonesia concerning rights to photographs.